5'RACE Adapter Ligation. CIP/TAP-treated RNA, 2 CIL, and 2 CIL of CIP-treated

RNA (minus-TAP control) was gently mixed with 1 CL 5'RACE adapter (5'-

GCUGAUGGCGAUGAAUGAACACUGCGU7UUGCUGGCU7UUGUAA-3) 1

CIL 10XRNA Ligase buffer (before use, the buffer was quickly warmed by rolling it

between gloved hands to resuspend any precipitate), T4 DNA Ligase (2.5 U/CIL), and

nuclease-free water in a total volume of 10 C1L. The mixture was incubated at 370C for 1

hour, after which it was stored at -200C.

 Reverse transcription (RT). Ligated RNA, 2C1L, or minus-TAP control were

gently mixed with 4 CIL dNTP mix, 2 CIL random decamers, 2 CIL 10XRT buffer, 1 C1L

RNase inhibitor, 1 CIL M-MLV reverse transcriptase, and nuclease-free water in a total

volume of 20 CIL. The mixture was incubated at 420C (or 500C, see results) for 1 hour.

The reactions were stored at -200C.

 Outer PCR. Each tube contained: 1 CIL RT reaction, 5 C1L 10XPCR buffer, 4 C1L

dNTPmix (4 mM), 2 CIL gene-specific or outer control (reverse) primer (10 CIM), 2 C1L

outer (forward) p ri mer ( 10 CM) (5'- GC TGAT GGC GAT GAAT GAAC AC TG-3'), 0.2 5

CIL Taq DNA polymerase (5 U/C1L), and nuclease-free water in a total volume of 50 CL.

A minus-template control was also included to ensure that one or more of the PCR

reagents was not contaminated with DNA.