The DNA templates selected were those identified from the previous study, that is,

the sequence isolated from liver (L6) and intestine (14). The primers used in this initial

study are shown in Table 5-4.

Table 5-4. Gene-specific primers used in initial 5'RLM-RACE study.

GSP ID Sequence (5' 3') Start positions PCR step

GSP OUT TGCTCTGAGGTCAGGTCGAA 397 Outer
GSP INN ACAGATACCCTCGTAGATGCCA 280 Inner
From 5' end of sense strand of partial sequence L6

 Based on homology with the complete sequences of Pleuronectes platessa UGT1

(PPL249081) and M\'acaca fascicularis UGTIAl (AF104339) it was estimated that, for

the UGT sequence isolated from catfish liver, this sequence needed to be extend by ~920

bp to the 5' -end, and ~183 bp to the 3'-end. Unfortunately, the use of these primers led

to sequences which still lacked the 5'-end (L15R, L25R, L35R, Il5R, I25R, I35R; see

Appendix A). In addition, a high degree of non-specific binding was noted.

 Design of GSPs for succeeding 5'- and 3'-RACE study. A new batch of GSPs

was designed (Table 5-5) using different criteria than the ones mentioned above in an

attempt to improve sensitivity. Primer 3.0 Software (http://frodo.wi .mit.edu/cgibin/

primer3/primer3_wYww.cgi) was used to design primers, based on the following criteria:

 a. For 5'-RACE, GSPs with a GC-clamp at the 3'-end in order to reduce non-

specific binding were used,

 b. The outer and inner primer melting temperatures for the GSPs were within a

degree of the RACE kit supplied primers,

 c. For 5'-RACE, the inner primer was long (~27 bp) in order to reduce nonspecific

binding, and